Question 1
Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA.

Question 1
Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA.
Consider the following DNA string.
• “AAATGCCCTAACTAGATTAAGAAACC”
Which one of the following is the gene returned using that algorithm?

A)The empty string.

B)ATGCCCTAACTAGATTAA

C)ATGCCCTAA

D)CCC

E)ATGCCC

About the author
Emery

1 thought on “Question 1<br /> Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. <br”

Leave a Reply to Hadley Cancel reply