Contact Style About

Question 1
Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA.
By Emery

Question 1
Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA.
Consider the following DNA string.
• “AAATGCCCTAACTAGATTAAGAAACC”
Which one of the following is the gene returned using that algorithm?

A)The empty string.

B)ATGCCCTAACTAGATTAA

C)ATGCCCTAA

D)CCC

E)ATGCCC

About the author
Emery

what are the precautions taken by you after dessecting sheep kidney ?​

13. Express
as a rational number with numerator (i) –6 (ijs 2
-117
14. Write each of the following rational numbers

1 thought on “Question 1<br /> Consider the assignment that goes with this lesson and its algorithm for finding a gene with stop codon TAA. <br”

Leave a Comment